homecontactvideos
logo
catcatcatcatcatcatcatcatcat
 
side

Username:
 Password:

Remember

Not a Member Yet?
Take advantage of our site by
taking a few seconds to Signup!
side
yashmon (157493 games)
HURRICANEgo (50695 games)
bpgflash (8638 games)
newski28 (616 games)
gmenrock (563 games)

>> View All Members
side
1. Battle Grounds 2
2. Adrenaline
3. Sim Girls
4. Dirt Bike
5. Spank The Monkey
side
1.Car Race
2.Land_survival_dk
3.Mad Spiders
4.Poker Splash
5.Power Ball
side
VideosArcade.com
Hot Favourite Games
Games Play
xGamesZone
PlayGamesClub.com
Myspace Games
MyFreeOnlineGames
Download Games
Addicting Games
ChubbyGames
Adbrite
more links ...
>>your link here<<
side
Total Games: 2994
Played Today: 0
Overall Played: 241580
Total Members: 117
Newest Member: alexamcbrian5310

Users Online: 5 (0 members and 5 guests)
Click to see the Newest Content RSS Feed
Click to see the Most Popular Content RSS Feed
Click to see the Random Content RSS Feed
Click to see more RSS Feeds
Browse Our Database of Role Playing Games
Age of Castle Icon
0 Stars Icon
Age of Castle
Battle over 60 enemies throughout the town in this fun strategy game! Goblins, Orcs and the dreaded dragons are all out to destroy your castle!
Ant War Icon
0 Stars Icon
Ant War
Clowns are increasingly killing citizens. Scientists found out why the clowns are killing, that it’s a DNA spliced with rat hormones. People were purposely poisoned with it. Your job is to clear the streets of crazed clowns so citizens are safe.
Armor RPG Experiment Icon
0 Stars Icon
Armor RPG Experiment
Power up your attack, magic, and defense, and clash against your evil opponent to win experience and items.
Attack Of The Goblins Icon
0 Stars Icon
Attack Of The Goblins
Build your army of goblins, orcs, warriors, and archers, fortify your base and assault the enemy castle.
Battle - Tactics United Icon
0 Stars Icon
Battle - Tactics United
Choose your attack, use your sword or battle with magic, kill enemies, gain experience and level up.
Battle For Gondor Icon
0 Stars Icon
Battle For Gondor
Take your troops into battle, defend your land against peons, orc and other enemies.
Battle Grounds 2 Icon
5 Stars Icon
Battle Grounds 2
This is the sequel of Battlegrounds. Its moreRTS-ish,and has lots of new units, buildings, scrolling maps and such. As you play, more buildings will be avaible for you to build. You will also be able to build more houses in later missions.
Battle Star Empire Icon
0 Stars Icon
Battle Star Empire
Build up your city while defending against the Scarlet Forces in this addictive strategy game.
Battle! Icon
0 Stars Icon
Battle!
Power up use healing potions and special attacks. Slash the enemy ball using your massive sword.
Bot Arena (Beta) Icon
0 Stars Icon
Bot Arena (Beta)
Upgrade your bots, buy them better cannons and nailguns and go against enemy bots to win money.
Bouncin Bop Icon
0 Stars Icon
Bouncin Bop
Bouncin Bop is a great adventure game with 5 episodes and 100 levels total.
Bow Adventure Icon
0 Stars Icon
Bow Adventure
Princess Yaya has been kidnapped by the evil wizard Grizwald and is being held captive in Castle Doom (how original)! Your task, dear hero, is to save her from Grizwald's evil clutches and destroy his minions on the way.
Cannon Ball Icon
0 Stars Icon
Cannon Ball
Aim the cannon and try to shoot the enemies castle!
Cannon Commander Icon
0 Stars Icon
Cannon Commander
Aim your cannon power up and fire defend your castle from strange funky looking invaders.
CC-Stealth Wars Icon
0 Stars Icon
CC-Stealth Wars
Use your cunning stealth and sneak around corners to get past guards.
Clash n Slash Icon
0 Stars Icon
Clash n Slash
Blast tons of aliens with loads of upgrades, powerups, enemies, and huge bosses.
Coffee Tycoon Icon
0 Stars Icon
Coffee Tycoon
Start the Starbucks! Coffee Tycoon is caffeine powered coffee shop empire building fun. Choose from dozens of store upgrades and coffee recipes to customize your business in Coffee Tycoon.
Crimson Warfare Icon
0 Stars Icon
Crimson Warfare
Build up your troopers tanks and other weaponry and send them off to destroy the enemy base.
Dealer Icon
0 Stars Icon
Dealer
An online version of the addictive Drug Wars game.
Demon Icon
0 Stars Icon
Demon
Move both red and blue dots into their proper places.
Demonic Defence 3 Icon
0 Stars Icon
Demonic Defence 3
Build your castle upgrade walls, add gunners, towers, archers, use spells and runes to defend it.
Diam Icon
0 Stars Icon
Diam
Play a very fun and challenging board game that requires a lot of strategy.
Electro Man Icon
0 Stars Icon
Electro Man
very fun, delicate hand person, skill game
Field Command 2 Icon
0 Stars Icon
Field Command 2
As a corporal, you must command your troops to infiltrate Iraqi bases while killing enemy soldiers and destroy tanks.
Fierce Battle Icon
0 Stars Icon
Fierce Battle
Power up your attack, buy stronger swords, use healing potions, and slice through the enemy circle.
Fire Play 2 Icon
0 Stars Icon
Fire Play 2
Blow up your opponents before they try to kill you!
Flash Craft Icon
0 Stars Icon
Flash Craft
Defend your Tower
Fortress Game Icon
0 Stars Icon
Fortress Game
Power up set angle and throw shoes or rocks at the opponent hit them with double hitters and super hits.
Frosty service Icon
0 Stars Icon
Frosty service
Make as many ice cream desserts as possible before the time runs out!
Global Player Icon
0 Stars Icon
Global Player
Your job is the make sure everything goes right at the drop point.
1 2 3 next
ArcadeRank.com Arcade Top Site Ranks Top 100 Arcades Best Flash Game Sites Arcade Top Sites Top Arcade Arcade Topsite
Arcade Top Sitez Top Arcade Sites free top game links Arcade Top Site The Best Arcade Sites on the Net! Top Game Sites Online - Gaming4U.Net Mibbi Top Arcade Sites